View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2539_high_8 (Length: 223)

Name: NF2539_high_8
Description: NF2539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2539_high_8
NF2539_high_8
[»] chr3 (2 HSPs)
chr3 (17-89)||(35735362-35735434)
chr3 (168-205)||(35735513-35735550)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 35735362 - 35735434
Alignment:
17 atagcatcacaatgataagcatcctttaataatctatagaaatcattgtaagaagaacctcctggtttagcag 89  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
35735362 atagcatcacaatgataagcatcctttaataacctatagaaatcattgtaagaagaacctcctggtttagcag 35735434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 35735513 - 35735550
Alignment:
168 caagttcagttacctcttctcttttcacatcatcctta 205  Q
    ||||||||||||||||||||||||||||||||||||||    
35735513 caagttcagttacctcttctcttttcacatcatcctta 35735550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University