View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2539_low_10 (Length: 223)
Name: NF2539_low_10
Description: NF2539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2539_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 35735362 - 35735434
Alignment:
| Q |
17 |
atagcatcacaatgataagcatcctttaataatctatagaaatcattgtaagaagaacctcctggtttagcag |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35735362 |
atagcatcacaatgataagcatcctttaataacctatagaaatcattgtaagaagaacctcctggtttagcag |
35735434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 35735513 - 35735550
Alignment:
| Q |
168 |
caagttcagttacctcttctcttttcacatcatcctta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35735513 |
caagttcagttacctcttctcttttcacatcatcctta |
35735550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University