View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2540_low_7 (Length: 240)
Name: NF2540_low_7
Description: NF2540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2540_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 49487295 - 49487431
Alignment:
| Q |
1 |
ttgactaatccatagtagcctagtctgtgtgtaacatactaacaattaatgatccttttgcaacctttcattatgtgaa----ttaaaaggcatgcagag |
96 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49487295 |
ttgactaatccacagtagcctagtctgtgtgtaacatactaacaattaataattcttttgcaacctttcattatgtgaattatttaaaaggcatgcagag |
49487394 |
T |
 |
| Q |
97 |
tataaaattcagagagttgactgatcaaaccaaaatg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49487395 |
tataaaattcagagagttgactgatcaaaccaaaatg |
49487431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University