View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2541_high_4 (Length: 341)
Name: NF2541_high_4
Description: NF2541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2541_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 273 - 318
Target Start/End: Complemental strand, 12333133 - 12333088
Alignment:
| Q |
273 |
cacatatctaaacacttatgtttacgggctttgaccccctttgtaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12333133 |
cacatatctaaacacttatgtttacgggctttgaccccctttgtaa |
12333088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University