View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2541_high_9 (Length: 310)
Name: NF2541_high_9
Description: NF2541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2541_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 292
Target Start/End: Complemental strand, 29377986 - 29377846
Alignment:
| Q |
154 |
aagtatcggattctccccttacaaaagaaaaagacaattcttactccatagtactatccaaactaagattgtggacttttagactt--ttttcccttgta |
251 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
29377986 |
aagtatccgattctccccttacaaaagaaaaagacaattcttactccatagtactatccaaactaagattgtggacttttagactttttttttccttgta |
29377887 |
T |
 |
| Q |
252 |
ttatagttttactttaatttattaagattactagtgtattt |
292 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| ||||| |
|
|
| T |
29377886 |
ttatactcttactttaatttattaagattactagtatattt |
29377846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 29378126 - 29378055
Alignment:
| Q |
14 |
tacttggttcgtaaccgagacgtgtcgtgtgtagcaaacaatgtgcattttgctcataacaaatcgatgaac |
85 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
29378126 |
tacttgattcgtaaccgagacgtgtcgtgtgtagcaaacaatgtgcattttgctcaaaaaaaatcgatgaac |
29378055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University