View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2541_low_13 (Length: 310)

Name: NF2541_low_13
Description: NF2541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2541_low_13
NF2541_low_13
[»] chr6 (2 HSPs)
chr6 (154-292)||(29377846-29377986)
chr6 (14-85)||(29378055-29378126)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 292
Target Start/End: Complemental strand, 29377986 - 29377846
Alignment:
154 aagtatcggattctccccttacaaaagaaaaagacaattcttactccatagtactatccaaactaagattgtggacttttagactt--ttttcccttgta 251  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||| |||||||    
29377986 aagtatccgattctccccttacaaaagaaaaagacaattcttactccatagtactatccaaactaagattgtggacttttagactttttttttccttgta 29377887  T
252 ttatagttttactttaatttattaagattactagtgtattt 292  Q
    ||||| | ||||||||||||||||||||||||||| |||||    
29377886 ttatactcttactttaatttattaagattactagtatattt 29377846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 85
Target Start/End: Complemental strand, 29378126 - 29378055
Alignment:
14 tacttggttcgtaaccgagacgtgtcgtgtgtagcaaacaatgtgcattttgctcataacaaatcgatgaac 85  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||    
29378126 tacttgattcgtaaccgagacgtgtcgtgtgtagcaaacaatgtgcattttgctcaaaaaaaatcgatgaac 29378055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University