View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2541_low_15 (Length: 257)
Name: NF2541_low_15
Description: NF2541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2541_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 38 - 174
Target Start/End: Original strand, 34926812 - 34926946
Alignment:
| Q |
38 |
caaattcccacaagtatttttagagaatcaaacacaattttggtcgtcaaaattataatgagtactttactgatatttattgaaagagagttgataatat |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34926812 |
caaattcccacaagtatttttagagaatcaaacacaattttggtcatcaaaattataatgagtactttactgatatttattgaa--agagttgataatat |
34926909 |
T |
 |
| Q |
138 |
taatggtactactacaactaatatagtactggtatca |
174 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
34926910 |
taatagtactactgctactaatatagtactggtatca |
34926946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 34926992 - 34927066
Alignment:
| Q |
177 |
tgacattatcaatcacaataggtcaaaatcttcttcatttatgtc---cttcatttctacaatttggagaattat |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
34926992 |
tgacattatcaatcacaatgggtcaaaatcttcttcatttatgtccttcttcatttttacaatttggagagttat |
34927066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 197 - 243
Target Start/End: Original strand, 6014112 - 6014161
Alignment:
| Q |
197 |
ggtcaaaatcttcttcatttatgtccttc---atttctacaatttggaga |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
6014112 |
ggtcaaaatcttcttcatttatgtccttctttatttctaccatttggaga |
6014161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University