View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2541_low_19 (Length: 232)
Name: NF2541_low_19
Description: NF2541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2541_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 12333057 - 12332826
Alignment:
| Q |
1 |
ttaactatatccttcgaacacatgtttgtcagtatttaataggtctaggttttattgtcgtcat------------aaccagagaaagtagaaggttttt |
88 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
12333057 |
ttaactatatccttcgtacacatgtttttcagtatttaataggtctaggttttattgtcgtcattaattgagtcataaccagagaaaatagaaggttttt |
12332958 |
T |
 |
| Q |
89 |
ttactaaactnnnnnnnnnnn------gatttcctatatctaagttagtaacataaaataacaaattacctataaataatgtggtaaattcaaaagtgtg |
182 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12332957 |
ttactaaacaaaaaaaaaaaaaagaatgatttcctatatctaagttagtaacataaaataacaaattacctataaataatgtggtaaattcaaaagtgtg |
12332858 |
T |
 |
| Q |
183 |
tagaatactcacttgtttttaatagcaaatga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12332857 |
tagaatactcacttgtttttaatagcaaatga |
12332826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University