View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2542_high_8 (Length: 236)
Name: NF2542_high_8
Description: NF2542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2542_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 7155601 - 7155395
Alignment:
| Q |
20 |
acacaagtctcagtgtgtgtgtcgcaaaagttgctacagggatgtctaaagcaaaatgaattttctttgcctgtggttgttgagtgctattcttatgcaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7155601 |
acacaagtctcagtgtgtgtgtcgcaaaagttgctacggggatgtctaaagcaaaatgaattttctttgcctgtggttgttgagtgctattcttatgcaa |
7155502 |
T |
 |
| Q |
120 |
aaagcacagagctgtggttctgacataaaattgagtggtattcttatgcaaaaagtcactttaatcttgtgaaattatagaaaataggaatcaggtcctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7155501 |
aaagcacagagctgtggttctgacataaaattgagtggtattcttatgcaaaaagtcactttaatcttgtgaaattatagaaaataggaatcaggtccat |
7155402 |
T |
 |
| Q |
220 |
tgcttct |
226 |
Q |
| |
|
||||||| |
|
|
| T |
7155401 |
tgcttct |
7155395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University