View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2542_low_8 (Length: 239)
Name: NF2542_low_8
Description: NF2542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2542_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 2943633 - 2943841
Alignment:
| Q |
18 |
cttccaaatattcctgtgcaggtaaagttgaagcttaatatattcttatttctgacgtgtatacagaaaatgttgatgtttatattatgagtannnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2943633 |
cttccaaatattcctgtgcaggtaaagttgaagcttaatatattgttatttctgacatgtatacagaaaatgttgatgtttatattatgagtattttttt |
2943732 |
T |
 |
| Q |
118 |
nggtgttgttaatgaagccatattgaaggattctgattatggtgaagttgatagagctgagtgtcaatttactaccactggaactgttcttgacaatgga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2943733 |
tggtgttgttaatgaagccatattgaaggattctgattatggtgaagttgatagagctgagtgtcagtttactaccactggaactgttcttgacaatgga |
2943832 |
T |
 |
| Q |
218 |
acacaggtt |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
2943833 |
acacaggtt |
2943841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University