View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2543_low_2 (Length: 350)
Name: NF2543_low_2
Description: NF2543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2543_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 24 - 90
Target Start/End: Original strand, 38132727 - 38132793
Alignment:
| Q |
24 |
caaattatctgattaatcatgtaaaagcaaatcagatagtaaaagattgtggaaatatttgatgtgt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38132727 |
caaattatctgattaatcatgtaaaagcaaatcagatagtaaaagattgtgaaaatatttgatgtgt |
38132793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 197 - 281
Target Start/End: Original strand, 38133063 - 38133148
Alignment:
| Q |
197 |
atgcttttggaagtaacttctt-gttttcttctatgataacaataatgtaatgacgtggcgccacgtggggacattattgggtgga |
281 |
Q |
| |
|
||||||||| |||||| |||| |||||||| |||||| |||||| | |||| |||||||||||||||||||||||||||||| |
|
|
| T |
38133063 |
atgcttttgagagtaacatctttgttttcttatatgatggtgataatggagtgacttggcgccacgtggggacattattgggtgga |
38133148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University