View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2543_low_9 (Length: 252)
Name: NF2543_low_9
Description: NF2543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2543_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 40979546 - 40979776
Alignment:
| Q |
8 |
cagaggaagaatctggcagacttaattaactcgtgaaattaatacactattacgattcagatttgaaatcaattaatcatcaatttcaagaacaccacca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40979546 |
cagaggaagaatctggcagacttaattaactcgtgaaattaatacactattacgattcagatttgaaatcaattaatcatcaatttcaagaacaccacca |
40979645 |
T |
|
| Q |
108 |
caatgcaaactttgcaaaagtgattcttgactcatgaatcattatagtccttgaaag--aaannnnnnnnaacaggaatctatgtagcgtgccctgctct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
40979646 |
caatgcaaactttgcaaaagtgattcttgactcatgaatcactatagtccttgaaagaaaaaaaaaaattaacaggaatctatgtagcgtgccctgctct |
40979745 |
T |
|
| Q |
206 |
ttcatctatattgacaactcaaacgtgtttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40979746 |
ttcatctatattgacaactcaaacgtgtttg |
40979776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University