View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2544_low_1 (Length: 456)
Name: NF2544_low_1
Description: NF2544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2544_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 402 - 437
Target Start/End: Original strand, 2839902 - 2839937
Alignment:
| Q |
402 |
acgctggaaggtgttgtggtgagtagggttagggtt |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2839902 |
acgctggaaggtgttgtggtgagtagggttagggtt |
2839937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University