View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2544_low_2 (Length: 401)
Name: NF2544_low_2
Description: NF2544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2544_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 71 - 383
Target Start/End: Original strand, 735616 - 735928
Alignment:
| Q |
71 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735616 |
agaatagttttctacgatgaagctgatgataacgatatgtgggtgatttgtccgttcaagaattgctcaggttatctcttgaatgatgggtttcaaactg |
735715 |
T |
 |
| Q |
171 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaaagttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735716 |
ttattgatgcagattgccccatttgtcataggttattctgctcgcgatgcaacgttccttggcatgcaggtgaaacctgtcaacaattccaacacaacaa |
735815 |
T |
 |
| Q |
271 |
actcaaatgtgaaatccttgatccctgcgaaaaccatttttcaaagaagagagaatctccctctggtgataaagaaaatcttacaccagtttcacagtcc |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735816 |
actcaaatgtgaaatccttgatccctgcgaaaaccatttttcaaagaagagagaatctccctttggtgataaagaaaatcttacaccagtttcacagtcc |
735915 |
T |
 |
| Q |
371 |
aagtccttatgtc |
383 |
Q |
| |
|
||||||||||||| |
|
|
| T |
735916 |
aagtccttatgtc |
735928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 735555 - 735600
Alignment:
| Q |
1 |
ttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
735555 |
ttccgtcataggtcactggctaccgttcccgttccgacgagagcag |
735600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University