View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2544_low_3 (Length: 393)
Name: NF2544_low_3
Description: NF2544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2544_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 16 - 377
Target Start/End: Complemental strand, 52112531 - 52112172
Alignment:
| Q |
16 |
atgtgtattgttatcaagcaatgtctcttgagttggtaaatcatattccacaaatgaatttggatttccaacgacttcacaatagggtgttgagcacact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
52112531 |
atgtgtattgttatcaagcaatgtctcttgagttggtaaatcatattccacaaatgaatttggatttccaacgacttcgcaataggttgttgagcacact |
52112432 |
T |
|
| Q |
116 |
gcacacaatatgcgttttatttcacacca-tgctactacaatcactgatgcaagcagtttaatcaaaaattaattttgttgtaaaatccattgatgaaga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112431 |
gcacacaatatgcgttttatttcacaccaatgctactacaatcaccaatgcaagcagtttaatcaaaaattaattttgttgtaaaatccattgatga--- |
52112335 |
T |
|
| Q |
215 |
ggctaggtttcttcttaaacatgtgcatagtttactactaatacaaacacttcaataactttgctaatcaataatatggttggctttatgtaatgagtaa |
314 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112334 |
ggctaggtttcttcttcaacatgtgcatagtttaatactaatacaaacacttcaataactttgctaatcaataatatggttggctttatgtaatgagtaa |
52112235 |
T |
|
| Q |
315 |
agcaaacgacgtagaaggaattgcaatctctaatgtaacagtacaacaggaaacagatatttg |
377 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52112234 |
agcaaacaacgtagaaggaattgcaatctctaatgtaacagtacaacaggaaacagatatttg |
52112172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University