View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2544_low_5 (Length: 310)
Name: NF2544_low_5
Description: NF2544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2544_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 4032010 - 4032215
Alignment:
| Q |
1 |
ctaccctctttcttcctttgttacgctcttgcttcttaattaatttctgaacagaaagtttaannnnnnnnatgatttttggtcgcagaaaagtatgaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4032010 |
ctaccctctttcttcctttgttacgctcttgcttcttaattaatttctgaaaggaaagtttaattttttt-atgatttttggttgcagaaaagtatgaaa |
4032108 |
T |
 |
| Q |
101 |
gagaagctaagaaatattgggatgtcttctacaaacaccacaaagacaaggttagttttccttattaagtttgttttgtactcatggttttgttagatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4032109 |
gagaagctaagaaatattgggatgtcttctacaaacaccacaaagacaaggttagttttccttattaagttcgttttgtactcatggttttgttagatta |
4032208 |
T |
 |
| Q |
201 |
tcactta |
207 |
Q |
| |
|
||||||| |
|
|
| T |
4032209 |
tcactta |
4032215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 246 - 293
Target Start/End: Original strand, 4032213 - 4032260
Alignment:
| Q |
246 |
ttagacgagacatcattagaccaaacttaaattttaagatgatcagag |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4032213 |
ttagacgagacatcattagaccaaacttaaattttaagatgatcagag |
4032260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University