View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2544_low_9 (Length: 243)
Name: NF2544_low_9
Description: NF2544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2544_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 12699561 - 12699335
Alignment:
| Q |
1 |
tgtgttgttcatttattggaagacttgaaactagcgaatccacatgttgcaacaactcgacattaaagcacagatcgacaactttatatcaatgttgctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||| |
|
|
| T |
12699561 |
tgtgttgttcatttattggaagacttgaaactagcgaatccacatgttgcaacaactcgacattaaagcacggatcgacaactttatagcagcgttgctc |
12699462 |
T |
 |
| Q |
101 |
tgacaattatacctttatggtcggttcacacggctgatcaagatgatgctgagtccaggttcaatttggtgacaaggcaattttgcggtggcagccacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12699461 |
tgacaattatacctttatggtcggttcacaccgctgatcaagatgatgctgactccaggttcaatttggtgacaaggcaattttgcggtggcagccacca |
12699362 |
T |
 |
| Q |
201 |
tggcgttgtcatgttaaatgaaatgtt |
227 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
12699361 |
tggcgttgtcgtgttaaatgaaatgtt |
12699335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University