View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2545_low_6 (Length: 243)
Name: NF2545_low_6
Description: NF2545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2545_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 33186194 - 33185998
Alignment:
| Q |
19 |
catctctacttaccaatttaaaatttaaaagaaaaatgaaataaccatttcccattccccattttccctctattaatcaatatttcaaaacatgtcgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33186194 |
catctctacttaccaatttaaaatttaaaagaaaaatgaaataaccatttcccatt-------ttccctctattaatcaatatttcaaaacatatcgaaa |
33186102 |
T |
 |
| Q |
119 |
ggacacttatacccctaacggttttcaacgcgcgcaaaactcaaattttaattagtcttcaacaagcttaaccgaatcagtttcattttcagttttctgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186101 |
ggacacttatacccctaacggttttcaacgcgcgcaaaactaaaatttcaattagtcttcaacaagcttaaccgaatcagtttcattttcagttttctgt |
33186002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University