View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2545_low_6 (Length: 243)

Name: NF2545_low_6
Description: NF2545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2545_low_6
NF2545_low_6
[»] chr5 (1 HSPs)
chr5 (19-222)||(33185998-33186194)


Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 33186194 - 33185998
Alignment:
19 catctctacttaccaatttaaaatttaaaagaaaaatgaaataaccatttcccattccccattttccctctattaatcaatatttcaaaacatgtcgaaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||| ||||||    
33186194 catctctacttaccaatttaaaatttaaaagaaaaatgaaataaccatttcccatt-------ttccctctattaatcaatatttcaaaacatatcgaaa 33186102  T
119 ggacacttatacccctaacggttttcaacgcgcgcaaaactcaaattttaattagtcttcaacaagcttaaccgaatcagtttcattttcagttttctgt 218  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
33186101 ggacacttatacccctaacggttttcaacgcgcgcaaaactaaaatttcaattagtcttcaacaagcttaaccgaatcagtttcattttcagttttctgt 33186002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University