View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2546_high_5 (Length: 271)
Name: NF2546_high_5
Description: NF2546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2546_high_5 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 130 - 271
Target Start/End: Complemental strand, 40582769 - 40582628
Alignment:
| Q |
130 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttaatgttcaggtgttaggacattgagcttccac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40582769 |
gatggaacttagcaagggacaccaacaccattgtttctggtgatagtaacccttcctattataaagttcatgttcaggtgttaggacattgagcttccac |
40582670 |
T |
|
| Q |
230 |
gccaataacaggtgtgctggtaaaattatgttgcctcgtgtc |
271 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40582669 |
gccaataacaattgtgctggtaaaattatgttgcctcgtgtc |
40582628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 67
Target Start/End: Complemental strand, 40582892 - 40582832
Alignment:
| Q |
7 |
tcgaagaatataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
67 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40582892 |
tcgaataaaataatatctatcggctaaaaatggtacttatatttagatgtttgacacacgt |
40582832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University