View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2546_low_4 (Length: 271)
Name: NF2546_low_4
Description: NF2546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2546_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 258
Target Start/End: Complemental strand, 54495362 - 54495120
Alignment:
| Q |
12 |
gcaaagggagtagaatgaatagtgagggatgggtgggggtcatataatctatgggattcacaaacacaacaagcagtgatttctaaagcatggatatcag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54495362 |
gcaaagggagtagaatgaatagtgagggatggg----ggtcatataatctatgggattcacaaacacaacaagcagtgatttctaaagcatggatatcag |
54495267 |
T |
|
| Q |
112 |
aaataataggtatatgttgtagaggtagatattttgcttgaaatgaggtagaactttagattaatctaaagattcaatagagactccttgactatttccc |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54495266 |
aaataataggtatatgttgtagaggtggatattttgcttgaaatgaggtagaactttagattaatctaaagattcaatagagacttcttgactatttccc |
54495167 |
T |
|
| Q |
212 |
attataactttttcctggccagtgcagggactaggatgggtggtatt |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54495166 |
attataactttttcctggccagtgcagggactaggatgggtggtatt |
54495120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University