View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2547_low_10 (Length: 233)
Name: NF2547_low_10
Description: NF2547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2547_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 100 - 200
Target Start/End: Original strand, 34885863 - 34885963
Alignment:
| Q |
100 |
ggttggaagattagtgttatggggtagacaaatggcaggtgggttgcatgcaaggacaaatgtcttaaccactgggccatttgttccagttgttttacaa |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885863 |
ggttgcaagattagtgttatggggtagacaaatggcaggtgggttgcatgcaaggacaaatgtcttaaccactgggccatttgttccagttgttttacaa |
34885962 |
T |
|
| Q |
200 |
a |
200 |
Q |
| |
|
| |
|
|
| T |
34885963 |
a |
34885963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University