View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2547_low_5 (Length: 345)
Name: NF2547_low_5
Description: NF2547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2547_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 276
Target Start/End: Original strand, 23407544 - 23407807
Alignment:
| Q |
15 |
catagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaattactttaatgtct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407544 |
catagggagggtggtggtgaacaaactggttcacctatgtacgattgaagaaagactagggagcatgtggcaatcttggagaaaaattactttaatgtct |
23407643 |
T |
|
| Q |
115 |
atggaggataataagtatatggttcaatttttataa-gtgatcgggagagaatttttcaaggaagtccttgactaattgat-aaaataagattatcttgc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||| |||||| |||||||||||||| |||||| ||| ||||||| |
|
|
| T |
23407644 |
atggaggataataagtatatggttcaattgttataaggtgatctggagagaatttttcatggaagtacttgactaattgataaaaatatgatcatcttgc |
23407743 |
T |
|
| Q |
213 |
agaacgttgctataggtgaagatcctatggttatccaaatgaacacagcggagatttgggttca |
276 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
23407744 |
agaaggttgctataggtgaagatcctatggctatccaaatgaacacaacggagatttgggttca |
23407807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 272 - 330
Target Start/End: Original strand, 23408825 - 23408883
Alignment:
| Q |
272 |
gttcattgggatagccatatggtcttcaccatcaacaaccttcttcaagatacatatgt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23408825 |
gttcattgggatagccatatggtcttcaccatcaacaaccttcttcaacatacatatgt |
23408883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University