View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2547_low_9 (Length: 238)

Name: NF2547_low_9
Description: NF2547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2547_low_9
NF2547_low_9
[»] chr3 (1 HSPs)
chr3 (17-238)||(51934510-51934731)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 51934731 - 51934510
Alignment:
17 ataatgacataaatgtgttcaagcatgataaaggatttaagaatgcaaaactgaatcatataggaagtgatatattttagatggattcctactaatgctt 116  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51934731 ataatgacataaatgtgttcaagcatgataaaggatttaaaaatgcaaaactgaatcatataggaagtgatatattttagatggattcctactaatgctt 51934632  T
117 tgcaaaataacacatattagctatgaatatggtcggcataaaacttaatgcgataaaattgctaaaagtattgattaacgctggcatgattacaatgaat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51934631 tgcaaaataacacatattagctatgaatatggtcggcataaaacttaatgcgataaaattgctaaaagtattgattaacgctggcatgattacaatgaat 51934532  T
217 tggaaaattatgaaataactac 238  Q
    ||||||||||||||||||||||    
51934531 tggaaaattatgaaataactac 51934510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University