View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2548_high_2 (Length: 230)
Name: NF2548_high_2
Description: NF2548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2548_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 37505830 - 37506034
Alignment:
| Q |
11 |
gtgaaaagaatgtcgagggaagaggatgaggagttgagctgggatgttgaagatgaggagtatgaagatgatgactttgatgataagagattgaataatg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505830 |
gtgaaacgaatgtcgagggaagaggatgaggagttgagctgggatgttgaagatgaggagtatgaagatgatgactttgatgataagagattgaataatg |
37505929 |
T |
|
| Q |
111 |
tggaagaagtggatgattttcaaggggaagagtctaaggttgaaaaaagagatagtttattgcaaaacaagatgatggaggaatcaaaagttgatgagaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505930 |
tggaagaagtggatgattttcaaggggaagagtctaaggttgaaaaaagagatagtttattgcaaaacaagatgatggaggaatcaaaagttgatgagaa |
37506029 |
T |
|
| Q |
211 |
tttgg |
215 |
Q |
| |
|
||||| |
|
|
| T |
37506030 |
tttgg |
37506034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University