View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2548_low_3 (Length: 230)

Name: NF2548_low_3
Description: NF2548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2548_low_3
NF2548_low_3
[»] chr7 (1 HSPs)
chr7 (11-215)||(37505830-37506034)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 37505830 - 37506034
Alignment:
11 gtgaaaagaatgtcgagggaagaggatgaggagttgagctgggatgttgaagatgaggagtatgaagatgatgactttgatgataagagattgaataatg 110  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37505830 gtgaaacgaatgtcgagggaagaggatgaggagttgagctgggatgttgaagatgaggagtatgaagatgatgactttgatgataagagattgaataatg 37505929  T
111 tggaagaagtggatgattttcaaggggaagagtctaaggttgaaaaaagagatagtttattgcaaaacaagatgatggaggaatcaaaagttgatgagaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37505930 tggaagaagtggatgattttcaaggggaagagtctaaggttgaaaaaagagatagtttattgcaaaacaagatgatggaggaatcaaaagttgatgagaa 37506029  T
211 tttgg 215  Q
    |||||    
37506030 tttgg 37506034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University