View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2549_high_9 (Length: 228)
Name: NF2549_high_9
Description: NF2549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2549_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 53 - 222
Target Start/End: Original strand, 30654649 - 30654818
Alignment:
| Q |
53 |
gttattgtttttgcgacctatgtttgatttcctaacgtttctctgccgctctttctaaggttgtcgttgctttgtggtttgccggttcgtgggttccagt |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
30654649 |
gttattgtttttgcgacctatgtttgatttcttaacgtttctctgccgctctttctaaggttaccattgctttgtggtttgctggttcgtgggttccagt |
30654748 |
T |
 |
| Q |
153 |
ccaagttcagatctgcgtgtttagatgctcgctccggtcgctagcttctgcttcggtaaagctcatgcac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30654749 |
ccaagttcagatctgcgtgtttagatgctcgcttcggccgctagcttctgcttcggtaaagctcatgcac |
30654818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University