View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2549_low_3 (Length: 396)
Name: NF2549_low_3
Description: NF2549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2549_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 9 - 364
Target Start/End: Complemental strand, 30769825 - 30769470
Alignment:
| Q |
9 |
gagatgaactgcgatccacgaccacgattctggtgtcaccgcctacataacataaagacttatcgtgagggcgcggcattatgtggcctccgtagctgca |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769825 |
gagaagaactgcgatccacgaccacgattctggtgtcaccacctacataacatagagacttatcatgagggcgcggcattatgtggcctccgtagctgca |
30769726 |
T |
|
| Q |
109 |
catgagccgaagcttgcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatcgtggtggtggctgtggtggtggcgatgat |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30769725 |
cattagccgaagcttgcctccggggacattagggaaggaatcgtcgttcattgtttcattaacgcgtgatcgtggtggtggctgtggtggtggcgatgat |
30769626 |
T |
|
| Q |
209 |
aaagactcgaccgattcaggatagttttgttggatgatgttatgaggaatggtggttgcggcggtggagataagtggtggatccattagaattggtgagt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30769625 |
aaagactcgaccgattcaggatagttttgttggatgatgttatgaggaatggtggttgcggcggtggagataagcggtggatccattagaattggtgagt |
30769526 |
T |
|
| Q |
309 |
tttggaataaaatgaaacggagcggaacagaacagaatagagtctctgatcactct |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
30769525 |
tttggaataaaatgaaacggagcggaacagaacaggatggagtctctgatcactct |
30769470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University