View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2549_low_8 (Length: 248)
Name: NF2549_low_8
Description: NF2549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2549_low_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 52369426 - 52369198
Alignment:
| Q |
17 |
ttatgggggtgtctgttactgatttgtcaaataatgggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacacatgattcttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52369426 |
ttatgggggtgtctgttactgatttgtcaaat---gggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacatatgattcttga |
52369330 |
T |
 |
| Q |
117 |
aagaaaccattcatttgttcaagataaagaacaaaacatggattcatccaaaagtgatcaattgaaacataaacaagttccagtgatttctctgcctgaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52369329 |
aagaaaccattcatttgttcaagataaagaacagaacatggattcaaccaaaagtgatcaattgaaacataaacaagttccattgatttctctgcctgaa |
52369230 |
T |
 |
| Q |
217 |
gcacttgttttttcttctccaagaccagtttc |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
52369229 |
gcacttgttttttcttctccaaggccagtttc |
52369198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University