View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2551_high_10 (Length: 245)
Name: NF2551_high_10
Description: NF2551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2551_high_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 34 - 245
Target Start/End: Original strand, 40125528 - 40125739
Alignment:
| Q |
34 |
gaagctgctctttggctaaaataaagtagttgtatttttatcttatttttggttaagaaaaagtagatgtttaagttgtggatgtgaggtctatgacgaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40125528 |
gaagctgctctttggctaaaataaagtagttgtatttttatcttatttttggttaagaaaaagtagatgtttaagttgtggatgtgaggtctatgacgaa |
40125627 |
T |
 |
| Q |
134 |
tacatacatagtttatgaatttaatataccagcaaatcataggtaaatgatttttgtgatcctaaattggctatatggccacacattgtagaaatgcagg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40125628 |
tacatacatagtttatgaatttaatataccagaaaatcataggtaaatgatttttgtgatcctaaattggctatatggccacacattgtagaaatgcagg |
40125727 |
T |
 |
| Q |
234 |
ttttttaatttt |
245 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40125728 |
ttttttaatttt |
40125739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University