View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2551_high_11 (Length: 237)
Name: NF2551_high_11
Description: NF2551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2551_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 29 - 147
Target Start/End: Complemental strand, 33404194 - 33404076
Alignment:
| Q |
29 |
agaatgagagtaatattannnnnnnccagcataaatgaaatttaattaacaataaagaagaggactacaagattctttacgatcagcgacaatcaaatta |
128 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33404194 |
agaatgagagtaatattatttttttccagtataaatgaaatttaattaacaataaagaagaggactacaagattctttacgatcagcgacaatcaaatta |
33404095 |
T |
|
| Q |
129 |
tctaaactagaataggatg |
147 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33404094 |
tctaaactagaataggatg |
33404076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 33404059 - 33404021
Alignment:
| Q |
163 |
gacaaaatgacaagatggatgattttctcataagttaca |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
33404059 |
gacaaaacgacaagatggatgattttctcataagctaca |
33404021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University