View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2551_low_15 (Length: 234)
Name: NF2551_low_15
Description: NF2551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2551_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 27 - 220
Target Start/End: Original strand, 33287083 - 33287276
Alignment:
| Q |
27 |
atgatgttcattaaatgcatgtccaaagccctttttaattgccacttctttccatttgtcaaactctaccactgttttcgacgctgtagtaccatggcca |
126 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
33287083 |
atgatgttcattaaatgcatgttcaaagccctttttaattgccacttctttccatttgtcaaactcggacactgttttcgacactgtagtaccatggcca |
33287182 |
T |
|
| Q |
127 |
acataagtcacaacagaccctttggttacaattgcccaccctgtctcattcttgtacgaaagcaatttctcaacctgttgttttacactctctg |
220 |
Q |
| |
|
||| | |||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33287183 |
acagcaatcacaatagaacctttggttacaattgcccaccctgtctcattcttgtacgaaagcaatttctcaacctgttgttttacactgtctg |
33287276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 50 - 213
Target Start/End: Complemental strand, 33141000 - 33140837
Alignment:
| Q |
50 |
caaagccctttttaattgccacttctttccatttgtcaaactctaccactgttttcgacgctgtagtaccatggccaacataagtcacaacagacccttt |
149 |
Q |
| |
|
||||||| || || || ||||| |||||||||||||||||||| |||||| ||| | ||| ||| ||||| |||||| ||||||||| ||||||||| |
|
|
| T |
33141000 |
caaagcctttattgatcgccacatctttccatttgtcaaactcggacactgtcttcaaaactgaagtcccatgaccaacagaagtcacaatagacccttt |
33140901 |
T |
|
| Q |
150 |
ggttacaattgcccaccctgtctcattcttgtacgaaagcaatttctcaacctgttgttttaca |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
33140900 |
ggttacaattgcccacccagtctcattcttgtaagaaagcaatttctcaacctgttgtgttaca |
33140837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 33159560 - 33159463
Alignment:
| Q |
110 |
ctgtagtaccatggccaacataagtcacaacagaccctttggttacaattgcccaccctgtctcattcttgtacgaaagcaatttctcaacctgttgt |
207 |
Q |
| |
|
||||||| ||||| |||||| | |||||| ||| ||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
33159560 |
ctgtagtcccatgaccaacagcaatcacaatagaacctttggttacaattgcccaccctgactcatttttgtaagaaagcaatttctcaacctgttgt |
33159463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 33182404 - 33182307
Alignment:
| Q |
110 |
ctgtagtaccatggccaacataagtcacaacagaccctttggttacaattgcccaccctgtctcattcttgtacgaaagcaatttctcaacctgttgt |
207 |
Q |
| |
|
||||||| ||||| |||||| | |||||| ||| ||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
33182404 |
ctgtagtcccatgaccaacagcaatcacaatagaacctttggttacaattgcccaccctgactcatttttgtaagaaagcaatttctcaacctgttgt |
33182307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University