View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2551_low_5 (Length: 360)
Name: NF2551_low_5
Description: NF2551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2551_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 43 - 350
Target Start/End: Original strand, 5311516 - 5311823
Alignment:
| Q |
43 |
tgcttcaacattgttcaaaattatgactgaaattagacagaaaatgccaggaatgacagaaatggaaataacatacttgggcggagacagccttggcaag |
142 |
Q |
| |
|
||||||||| | |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
5311516 |
tgcttcaacgtcgttcaaaattatgatgcaaattggacagaaaatgccaggaatgacagaaatggaaataccatacttgggcagagacagccgtggcaag |
5311615 |
T |
|
| Q |
143 |
ttcatttggaatacttttaggacggctaataaattttccgagtgtatcaaggagagatcccgacaacacactcacgaagaacacatttccaactagaaag |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
5311616 |
ttcatttggaatacttttaggacggctaataaattttccgagtgtatcaaggagagatcccgataagacactcacgaagaacacgtttccaactagaaaa |
5311715 |
T |
|
| Q |
243 |
tagaaaaccatgttgcaggctttgatttcctccttacttcttgcaacacatccagctactttagccatagcaaacattgcaaatgggacaacgtatataa |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
5311716 |
tagaaaaccatgttgcaggctttgatttcctccttacttcttgcaacacatccagctacttttgccatagcaaacattgcaaatggcacaacatatataa |
5311815 |
T |
|
| Q |
343 |
atcctttg |
350 |
Q |
| |
|
|||||||| |
|
|
| T |
5311816 |
atcctttg |
5311823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University