View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2551_low_7 (Length: 292)
Name: NF2551_low_7
Description: NF2551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2551_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 38846836 - 38847109
Alignment:
| Q |
1 |
tgcatctttgctgggagcagaaatgacaaccttcttggcaccaccctaatcaccacaacaatccaaatt------acacacatttcaaatttaaactata |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38846836 |
tgcatctttgctgggagcagaaatgacaaccttcttggcaccaccctaatcaccacaacaatccaaattcaaattacacacatttcaaatttaaactata |
38846935 |
T |
 |
| Q |
95 |
gaaatctaattaattaactgtttttagtaaattat-agtactcaatatcattgtatcaatcaatcaaacagggaacaactaacaatatgtaaacataata |
193 |
Q |
| |
|
|||||||||| || |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38846936 |
gaaatctaatcaa----ctgtttttagtagattattagtactcaatatcattgtatcaatcaatcaaacagggaacaactaacaatatgtaaacataata |
38847031 |
T |
 |
| Q |
194 |
ctagtcgactgtaacaaaacacaaaacacacgattcatatcaaataaacaaataataacagactatcaagcattgtct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38847032 |
ctagtcgactgtaacaaaacacaaaacacatgattcatatcaaataaacaaatgataacagactatcaagcattgtct |
38847109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University