View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_13 (Length: 452)
Name: NF2552_high_13
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 146 - 418
Target Start/End: Complemental strand, 33185431 - 33185159
Alignment:
| Q |
146 |
ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185431 |
ctgaattacgcatgatttaattttgcttctttatcaggttctcttgaattggatcggttcaattttgcaaaagaattgatttttcagtttgttttctgaa |
33185332 |
T |
 |
| Q |
246 |
ttagggtatgcttgaattttgggtctttttcagattcttgnnnnnnnntggtattttgttgtcttgattaagggcttttgataataatttgattgtttcc |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33185331 |
ttagggtatgcttgaattttgggtctttttcagattcttgaaaaaaaatggtattttgttgtcttgattaagggtttttgataataatttgattgtttcc |
33185232 |
T |
 |
| Q |
346 |
caaataccaattttggatttttcagtttgatttctgaattgcatttcgtaaatattccaaatgcaaatttcga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
33185231 |
caaataccaattttggatttttcagtttgatttctgaattgcatttggtaaacattccaaatgcaaatttcga |
33185159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 33185576 - 33185504
Alignment:
| Q |
1 |
actcttctcatcctttctgtgatcattgccgttgtgtaggttcgttttcaagttctgatttttatttcatggg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33185576 |
actcttctcatcctttctgtgatcattgccgttgtgtaggttcgttttcaagttctgatttttatttcatggg |
33185504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 32273380 - 32273327
Alignment:
| Q |
223 |
gatttttcagtttgttttctgaattagggtatgcttgaattttgggtctttttca |
277 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||| |||| ||||| |
|
|
| T |
32273380 |
gatttttcagtttgtgttctaaatt-gggtatgcttgaattttgagtctctttca |
32273327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 340 - 374
Target Start/End: Complemental strand, 32273401 - 32273367
Alignment:
| Q |
340 |
gtttcccaaataccaattttggatttttcagtttg |
374 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32273401 |
gtttcccaaatgccaattttggatttttcagtttg |
32273367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University