View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_14 (Length: 451)
Name: NF2552_high_14
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 164 - 298
Target Start/End: Complemental strand, 49992000 - 49991862
Alignment:
| Q |
164 |
actattaaggatgaatttaaaaacaggatatgctcaattgataagtttttatactattaccaa-annnnnnnnatttaatcaatgagatcttatatttaa |
262 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49992000 |
actattaaggatgaattcaaaaacaggatatgctcaattgataagtttttatactattaccaattttttatttatttaatcaatgagatcttatatttaa |
49991901 |
T |
 |
| Q |
263 |
aaacatatgtaaa---agttaactagacttagtcatatg |
298 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49991900 |
aaacatatgtaaaattagttaactagacttagtcatatg |
49991862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 352 - 445
Target Start/End: Complemental strand, 49991814 - 49991721
Alignment:
| Q |
352 |
acgacacaaaacttggtgccccatataggtagtatacaaattctgttctttttctgtaaatacatctattgtttatgattgatgtctgtgctgc |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
49991814 |
acgacacaaaacttggtgccccatataggtagtatacaaattatgttctttttctgtaaatacatctattgtttatgattgatgtgtttgctgc |
49991721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 49992140 - 49992079
Alignment:
| Q |
19 |
actttgaatcttatactaccttcatctttaagtatatgtctgttttgaagaaaattcttgtc |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49992140 |
actttgaatcttatactaccttcatctttaagtatatgtctgttttgaagaaaattcttgtc |
49992079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University