View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_23 (Length: 338)
Name: NF2552_high_23
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 47456087 - 47456368
Alignment:
| Q |
1 |
aggagaagctaccaagcttaggtaatgatcaatatcccctaaactattaaataattgcatttatgtatcagtataggttagatatataacatcattgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47456087 |
aggagaagctaccaagcttaggtaatgatcaatatcccctaaactattaaataattgcatttatgtatcagtataggttagatatataacatcattgtaa |
47456186 |
T |
|
| Q |
101 |
atggtgagaccatgaattggaataaccgaataattgcattttgtcgtaagaggggtttgaatcatgtaaaacaagtgttcagattctaaaatccgggtgt |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47456187 |
atggtgagaccatgagttggaataaccgaataattgcattttgtcgtaagaggggtttgaatcatgtaaaacaagtgttcagattctaaaatccgggtgt |
47456286 |
T |
|
| Q |
201 |
gttaaaaatagttttat-ccccccggttaattatgaaattgtattttgacataagaggggttcaaaacatataaatgaggtg |
281 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47456287 |
gttaaaaatagttttatcccccccggttaattatgaaattgtattttgacataagaggggttcaaaacatataaatgaggtg |
47456368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University