View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_25 (Length: 309)
Name: NF2552_high_25
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 183 - 288
Target Start/End: Original strand, 41550603 - 41550708
Alignment:
| Q |
183 |
acgactccaaaacataacaccaaataattcttgttgagctttattaagattatgcatagcagataacacactatgagtgaccaaggtattagttagtatc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41550603 |
acgactccaaaacataacaccaaataattcttgttgagctttattaagattatgcatagcagataacacattatgagtgaccaaggtattagttagtatc |
41550702 |
T |
 |
| Q |
283 |
gagtac |
288 |
Q |
| |
|
|||||| |
|
|
| T |
41550703 |
gagtac |
41550708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University