View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_35 (Length: 264)
Name: NF2552_high_35
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 254
Target Start/End: Original strand, 28439367 - 28439600
Alignment:
| Q |
19 |
gatcaaagcctgtaacattgctctttctctctcaatcttcctattttcaccctatcttagcagtgtggtgcaatttggtgtctgtaaagtttaatgaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28439367 |
gatcaaagcctgtaacattgctctttctctctcaatcttcctattttcactctatcttagcagtgtggtgcaatttggtgtctgtaaagtttaatgaatc |
28439466 |
T |
 |
| Q |
119 |
actgccaacttttgaataagttannnnnnnnnnnnnnnnnatattttcagattttaatgttacattaatagtaaattagcatttttctcttcaaaattgt |
218 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28439467 |
actgccaacttttgaataagtta--agagagagagagagaatactttcagattttattgttacattaatagtaaattagcatttttctcttcgaaattgt |
28439564 |
T |
 |
| Q |
219 |
aagagtaaaacaatttacacttttaactcacctatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28439565 |
aagagtaaaacaatttacacttttaactcatctatg |
28439600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University