View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_41 (Length: 245)
Name: NF2552_high_41
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 16822577 - 16822461
Alignment:
| Q |
16 |
taaagaacacatgcattatacataaatttgttcccaattaatttgtaatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822577 |
taaagaacacatgcattatacataaatttgtccccaattaatttgtaatcaaaataattggtgaatagcttaatttgtatacaacatttagttaggtata |
16822478 |
T |
|
| Q |
116 |
caaatactacagctacc |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16822477 |
caaatactacagctacc |
16822461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 130 - 238
Target Start/End: Complemental strand, 16822373 - 16822265
Alignment:
| Q |
130 |
accatgagattattgaaaaaagttgcataagccatcttaatttctttgcatgagtacatgattataattttgtcttccatattattctccctctaatttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16822373 |
accatgagattattgaaaaaagttgcataagccatcttaatttctttgcatgagtacgtgattataattttgtcttccatattattctccctctaatttc |
16822274 |
T |
|
| Q |
230 |
tttcttctc |
238 |
Q |
| |
|
||||||||| |
|
|
| T |
16822273 |
tttcttctc |
16822265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University