View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_43 (Length: 230)
Name: NF2552_high_43
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_43 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 9386405 - 9386188
Alignment:
| Q |
13 |
aatatatggttgaaagatgatgcaaataattgatgcatagcaggggaacaaaccccagcaaggcagcaatgtttacgttctcataatgttcaccacaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9386405 |
aatatatggttgaaagatgatgcaaataattgatgcatagcaggggaacaaaccccagcaaggcagcaatgtttacgttctcataatgttcaccacaatt |
9386306 |
T |
 |
| Q |
113 |
ttctgaaagctctacgttgttcatgttatggccatggattaataaattgacttgagctaccgacttgctggcctaaattgtcagaaaaccatatgaaaca |
212 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9386305 |
ttctgaaagctctacgttgctcatgttatggccatggattaataaattgacttgagctaccgacttgctggcctaaattgtcagaaaaccatatgaaaca |
9386206 |
T |
 |
| Q |
213 |
taggatcacaaaacttgc |
230 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
9386205 |
tagggtcacaaaacttgc |
9386188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University