View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_high_46 (Length: 209)
Name: NF2552_high_46
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_high_46 |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 190
Target Start/End: Original strand, 1051502 - 1051694
Alignment:
| Q |
13 |
gagaagaagaaatgattactaagctcaaagttaattgagcaaaaaacacaagacatataatggtagacatcacccctcttctagccaaagcctctttaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1051502 |
gagaagaagaaatgattactaagctcaaagttaattgagcaaaaaacacaagacatataatggtagacatcacccctcttctagccaaagcctctttaga |
1051601 |
T |
 |
| Q |
113 |
tgctagtctcccttgaagtaatctccaaa---------------ccataccttttccaaagccttttatgaaaaccagatcactagattgaac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1051602 |
tgctagtctcccttgaagtaatctccaaaccataattttgttttccataccttttccaaagccttttatgaaaaccagatcactagattgaac |
1051694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 146
Target Start/End: Complemental strand, 1768 - 1631
Alignment:
| Q |
12 |
tgagaagaagaaatgattactaagctcaaagttaattgagcaaaaaacacaagacatat----aatggtagacatcacccctcttctagccaaagcctct |
107 |
Q |
| |
|
||||||||| |||| |||||||| ||||| ||| |||||||||||||||||||||||| ||||||||||| |||| |||| || ||| ||||| |
|
|
| T |
1768 |
tgagaagaaaaaat-attactaaactcaatattatttgagcaaaaaacacaagacatatcatgaatggtagacaatacccgtcttataagtaaatcctct |
1670 |
T |
 |
| Q |
108 |
ttagatgctagtctcccttgaagtaatctccaaaccata |
146 |
Q |
| |
|
|||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
1669 |
ttagttgctagtcccccttaaagtaatctccaaaccata |
1631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 126
Target Start/End: Complemental strand, 30390972 - 30390922
Alignment:
| Q |
76 |
tagacatcacccctcttctagccaaagcctctttagatgctagtctccctt |
126 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
30390972 |
tagacattacccctcttctagccaaagcatctctaattgctagtctccctt |
30390922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University