View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2552_low_15 (Length: 451)

Name: NF2552_low_15
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2552_low_15
NF2552_low_15
[»] chr1 (3 HSPs)
chr1 (164-298)||(49991862-49992000)
chr1 (352-445)||(49991721-49991814)
chr1 (19-80)||(49992079-49992140)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 164 - 298
Target Start/End: Complemental strand, 49992000 - 49991862
Alignment:
164 actattaaggatgaatttaaaaacaggatatgctcaattgataagtttttatactattaccaa-annnnnnnnatttaatcaatgagatcttatatttaa 262  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||||||||||||    
49992000 actattaaggatgaattcaaaaacaggatatgctcaattgataagtttttatactattaccaattttttatttatttaatcaatgagatcttatatttaa 49991901  T
263 aaacatatgtaaa---agttaactagacttagtcatatg 298  Q
    |||||||||||||   |||||||||||||||||||||||    
49991900 aaacatatgtaaaattagttaactagacttagtcatatg 49991862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 352 - 445
Target Start/End: Complemental strand, 49991814 - 49991721
Alignment:
352 acgacacaaaacttggtgccccatataggtagtatacaaattctgttctttttctgtaaatacatctattgtttatgattgatgtctgtgctgc 445  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||    
49991814 acgacacaaaacttggtgccccatataggtagtatacaaattatgttctttttctgtaaatacatctattgtttatgattgatgtgtttgctgc 49991721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 49992140 - 49992079
Alignment:
19 actttgaatcttatactaccttcatctttaagtatatgtctgttttgaagaaaattcttgtc 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49992140 actttgaatcttatactaccttcatctttaagtatatgtctgttttgaagaaaattcttgtc 49992079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University