View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_low_20 (Length: 400)
Name: NF2552_low_20
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 240 - 388
Target Start/End: Complemental strand, 45011391 - 45011243
Alignment:
| Q |
240 |
taaccgttcgactaccccttgcgcgctctctaattaaatatactcattttgccattaaaaaatgaggagaataataagtgtgttttaagatatggatcta |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45011391 |
taaccgttcgactaccccttgcgcgctctctaattaaatatactcattttgccattaaaaaaagagcagaataataagtgtgttttaagatatggatcta |
45011292 |
T |
|
| Q |
340 |
ctgattcgctctaacttatgataccattatgtttccctcttgacctttg |
388 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
45011291 |
ttgattcgctctaacttatgatgccattatgtttccctcttgatctttg |
45011243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 18 - 142
Target Start/End: Complemental strand, 45011671 - 45011547
Alignment:
| Q |
18 |
tttggatcattcttgtaccttacatgagtggaggatggaacttgtcttgtgtttggaccgttaattgattgtagcgttgtaatctgaggttgtttaaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45011671 |
tttggatcattcttgtaccttacatgagtggaggatggaacttgtcttgtgtttggaccgttaattgattgtagcgttgtaatctgaggttgtttaaaag |
45011572 |
T |
|
| Q |
118 |
gatgatattttgtgatgcaccgtct |
142 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
45011571 |
gatgatattttttgatgcaccgtct |
45011547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 45011486 - 45011453
Alignment:
| Q |
141 |
ctgatttggtgagactcttccaagttgtgtgtat |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
45011486 |
ctgatttggtgagactcttccaatttgtgtgtat |
45011453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University