View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_low_27 (Length: 308)
Name: NF2552_low_27
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 4 - 293
Target Start/End: Original strand, 29565163 - 29565452
Alignment:
| Q |
4 |
atgctatggctttcaatccaactcatgaacaagttttcatggatcctcatggttttaactcatatgaggttaagatgcaagaccaaaatcttcataaagg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29565163 |
atgctatggctttcaatccaactcatgaacaagttttcatggatcctcatggttttaactcctatgaggttaaaatgcaagaccaaaatcttcataaagg |
29565262 |
T |
 |
| Q |
104 |
tcttgttcatgagtcttcttatccacataacatggttttccaaatgcaacattcatcacaacattattcacatgcataaaggatcattgtagtgaattct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29565263 |
tcttgttcatgagtcttcttatccacataacatggttttccaaatgcaacattcatcacaacattattcacatgcataaaggatcattgtagtgaattct |
29565362 |
T |
 |
| Q |
204 |
taaactcaatattgcttcgagtgtctgaattttcccaaggtctcagtgattatgcaagaaagaagtaggatctcactgttatggtggatt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29565363 |
taaactcaatattgcttcgagtgtctgaattttcccaaggtctcagtgattatgcaagaaagaagtaggatctcactgttatggtggatt |
29565452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University