View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_low_28 (Length: 307)
Name: NF2552_low_28
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_low_28 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 77 - 307
Target Start/End: Complemental strand, 39479776 - 39479545
Alignment:
| Q |
77 |
ttataatcatgtaagtctctacttgctcattacagcctctactccgtgcttaaatcattaacatgtcaaagtgaacatcatcaaaaataggaatgcataa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479776 |
ttataatcatgtaagtctctacttgctcattgcagcctctactccgtgcttaaatcattaacatgtcaaagtgaacatcatcaaaaataggaatgcataa |
39479677 |
T |
|
| Q |
177 |
gcacaagttccaagcatgttcgtacaaatgagaaacaacaggaaaggcacaaagaggagcaaacaaggagatcatgaactcataattactaaaatgatgt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39479676 |
gcacaagttccaagcatgttcgtacaaatgagaaacaacaagaaaggcacaaagaggagcaaacaaggagatcatgaactcataattactaaaatgatgt |
39479577 |
T |
|
| Q |
277 |
tgtctcacat-gtcaagcaataacacatcatc |
307 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
39479576 |
tgtctcacatggtcaagcaataacacatcatc |
39479545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University