View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2552_low_41 (Length: 248)
Name: NF2552_low_41
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2552_low_41 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 54060785 - 54060556
Alignment:
| Q |
19 |
ctgctgcacatcaagaacgtcaacttgtattacttccaacctttgcatcaagtaaattattacatgaaaaataacgagtcttaaagatatgtgataacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54060785 |
ctgctgcacatcaagaacgtcaacttgtattacttccaacctttgcatcaagtaaattattacatgaaaaataacgagtcttaaagatatgtgataacaa |
54060686 |
T |
|
| Q |
119 |
cgaatccagttgcttaattaacttccgaccttgttttcccaaacgagccacgttaaaagtatataggttacgaaaacccattcctccatctttctgctta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54060685 |
cgaatccagttgcttaattaacttccgaccttgttttcccaaaagagccacgttaaaagtatataggttacgaaaacccattcctccatctttctgctta |
54060586 |
T |
|
| Q |
219 |
tatcaagcctatcccatgcaatgatataca |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
54060585 |
tatcaagcatatcccatgcaatgatataca |
54060556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University