View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2552_low_45 (Length: 230)

Name: NF2552_low_45
Description: NF2552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2552_low_45
NF2552_low_45
[»] chr5 (1 HSPs)
chr5 (13-230)||(9386188-9386405)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 9386405 - 9386188
Alignment:
13 aatatatggttgaaagatgatgcaaataattgatgcatagcaggggaacaaaccccagcaaggcagcaatgtttacgttctcataatgttcaccacaatt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9386405 aatatatggttgaaagatgatgcaaataattgatgcatagcaggggaacaaaccccagcaaggcagcaatgtttacgttctcataatgttcaccacaatt 9386306  T
113 ttctgaaagctctacgttgttcatgttatggccatggattaataaattgacttgagctaccgacttgctggcctaaattgtcagaaaaccatatgaaaca 212  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9386305 ttctgaaagctctacgttgctcatgttatggccatggattaataaattgacttgagctaccgacttgctggcctaaattgtcagaaaaccatatgaaaca 9386206  T
213 taggatcacaaaacttgc 230  Q
    |||| |||||||||||||    
9386205 tagggtcacaaaacttgc 9386188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University