View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_high_9 (Length: 278)
Name: NF2553_high_9
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_high_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 28132190 - 28132459
Alignment:
| Q |
1 |
cacagagacaagaaaaagtacagaaaccaataaatgttcaactcagtttgaaggcaggcaggttatgcaagactcggtagcagaatccgtagctaagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28132190 |
cacagagacaagaaaaagtacagaaaccaataaatgttcaactcagtttgaaggcaggcaggttatgcaagactcggtagcagaatccgtagctaagttt |
28132289 |
T |
|
| Q |
101 |
tacaacacaggagttgttaagaaactgttcataaatctc-aaaaattggcatgctaaaaattgtttagatgccacaaaggaagtacatacatcacaagtg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28132290 |
tacaacacaggagttgttaagaaactgttcataaatctcaaaaaattggcatgctaaaaattgtttag---------tggaagtacatacatcacaagtg |
28132380 |
T |
|
| Q |
200 |
aaagctacaagcatattgtttttgatattatataaagtaggatacacacaaaaaggaaaaacaaatcactttggcatac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
28132381 |
aaagctacaagcatattgtttttgatattatataaagtaggatacacacaaacaagaaaaacaaatcactttggcatac |
28132459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University