View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2553_low_14 (Length: 249)

Name: NF2553_low_14
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2553_low_14
NF2553_low_14
[»] chr6 (1 HSPs)
chr6 (45-210)||(2992304-2992469)


Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 45 - 210
Target Start/End: Complemental strand, 2992469 - 2992304
Alignment:
45 gtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttttgttgttcttttcgtgcttgtgcctaatttgtaacataacttgata 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2992469 gtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttttgttgttcttttcgtgcttgtgcctaatttgtaacataacttgata 2992370  T
145 ttcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgctgcactcttcga 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2992369 ttcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgctgcactcttcga 2992304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University