View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_14 (Length: 249)
Name: NF2553_low_14
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 45 - 210
Target Start/End: Complemental strand, 2992469 - 2992304
Alignment:
| Q |
45 |
gtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttttgttgttcttttcgtgcttgtgcctaatttgtaacataacttgata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2992469 |
gtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttttgttgttcttttcgtgcttgtgcctaatttgtaacataacttgata |
2992370 |
T |
 |
| Q |
145 |
ttcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgctgcactcttcga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2992369 |
ttcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgctgcactcttcga |
2992304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University