View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2553_low_15 (Length: 238)
Name: NF2553_low_15
Description: NF2553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2553_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 42339120 - 42339314
Alignment:
| Q |
18 |
ccttggatggccaatacagttcacccctgattggttgcaatgtgactgctcaactcatactactcatagtgcttaccatttaagcttttgcttgtagttt |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42339120 |
ccttggatgggcaatacagttcacccctgattggttgcaatgtgactgctcaactcatattactcatagtacttaccatttaagcttttgcttgtagttt |
42339219 |
T |
|
| Q |
118 |
aatgttttaatgacagaaatttgggaatgaagatatttagtccccttataaagtttattatgatgacccaggtgcggtggtgcgataaatatggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42339220 |
aatgttttaatgacagaaatttgggaatgaagatatttagtccccttataaagtttattatgatgacctaggtgcggtggtgcgataaatatggc |
42339314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University